flowcraft.templates.fastqc module

Purpose

This module is intended to run FastQC on paired-end FastQ files.

Expected input

The following variables are expected whether using NextFlow or the main() executor.

  • fastq_pair : Pair of FastQ file paths
    • e.g.: 'SampleA_1.fastq.gz SampleA_2.fastq.gz'

Generated output

The generated output are output files that contain an object, usually a string.

  • pair_{1,2}_data : File containing FastQC report at the nucleotide level for each pair
    • e.g.: 'pair_1_data' and 'pair_2_data'
  • pair_{1,2}_summary: File containing FastQC report for each category and for each pair
    • e.g.: 'pair_1_summary' and 'pair_2_summary'

Code documentation

flowcraft.templates.fastqc.convert_adatpers(adapter_fasta)[source]

Generates an adapter file for FastQC from a fasta file.

The provided adapters file is assumed to be a simple fasta file with the adapter’s name as header and the corresponding sequence:

>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Adapter_Index 1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Parameters:
adapter_fasta : str

Path to Fasta file with adapter sequences.
Returns:
adapter_out : str or None

The path to the reformatted adapter file. Returns None if the adapters file does not exist or the path is incorrect.